pcdna3 1 stim1 venus 173 c (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
pcdna3 1 stim1 venus 173 c
Pcdna3 1 Stim1 Venus 173 C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+1+stim1+venus+173+c/pcDNA3%2E1-STIM1-Venus-173-C+(Plasmid+%2387619)/pmc13034653-68-0-2
Average 94 stars, based on 4 article reviews
Pcdna3 1 Stim1 Venus 173 C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+1+stim1+venus+173+c/pcDNA3%2E1-STIM1-Venus-173-C+(Plasmid+%2387619)/pmc13034653-68-0-2
Average 94 stars, based on 4 article reviews
pcdna3 1 stim1 venus 173 c - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Cloning:Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658–5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry. Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: Hemodynamic stress activates inflammatory responses and cell death through spectrin-dependent modulation of Store Operated Calcium Entry Article Snippet: Enhanced GFP (EGFP ) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Fluorescence:Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658–5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry. Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: Hemodynamic stress activates inflammatory responses and cell death through spectrin-dependent modulation of Store Operated Calcium Entry Article Snippet: Enhanced GFP (EGFP ) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Bimolecular Fluorescence Complementation Assay:Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658–5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry. Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: Hemodynamic stress activates inflammatory responses and cell death through spectrin-dependent modulation of Store Operated Calcium Entry Article Snippet: Enhanced GFP (EGFP ) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Construct:Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658–5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry. Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: Hemodynamic stress activates inflammatory responses and cell death through spectrin-dependent modulation of Store Operated Calcium Entry Article Snippet: Enhanced GFP (EGFP ) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Amplification:Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658–5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry. Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: Hemodynamic stress activates inflammatory responses and cell death through spectrin-dependent modulation of Store Operated Calcium Entry Article Snippet: Enhanced GFP (EGFP ) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Plasmid Preparation:Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658–5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: A shear stress-responsive pathway in monocytes drives cardiopulmonary bypass-induced inflammation via spectrin/RAF1/store-operated calcium entry. Article Snippet: Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus’s fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and Article Title: Hemodynamic stress activates inflammatory responses and cell death through spectrin-dependent modulation of Store Operated Calcium Entry Article Snippet: Enhanced GFP (EGFP ) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8 -pCHD at the SalI and BamHI restriction sites. .. Cloning for bimolecular fluorescence complementation (BiFC) of store operated calcium entry (SOCE) genes lentivirus constructs: N-terminal Venus fragment fused to full-length ORAI1 and C-terminal Venus fused to full-length STIM1 were cut out and amplified from plasmids pcDNA3-Venus-173-N-ORAI1 (a gift from Jin Zhang; Addgene plasmid #87618) and other:Article Title: The Cytoplasmic Region of SARAF Reduces Triple-Negative Breast Cancer Metastasis through the Regulation of Store-Operated Calcium Entry Article Snippet: |